From Gene to Protein

What is the relationship among DNA, a gene and a chromosome?
1. A chromosome contains hundreds of genes, which are composed of protein.
2. A chromosome contains hundreds of genes, which are composed of DNA.
3. A gene contains hundreds of chromosomes, which are composed of protein.
4. A gene is composed of DNA, but there is no relationship to a chromosome
5. A gene contains hundreds of chromosomes, which are composed of DNA.
Which is one function of a signal peptide?
1. to direct an mRNA molecule into the cisternal space of the ER
2. to bind RNA polymerase to DNA and initiate transcription
3. to terminate translation of the messenger RNA
4. to attach ribosomes synthesizing secretory proteins to the ER
5. to signal the initiation of transcription.
The genetic code is essentially the sma for all organisms. From this, one can logically assume all of the following EXCEPT
1. A gene from an organism could theoretically be expressed by any other organism
2. All organisms have a common ancestor
3. DNA was the first genetic material
4. All organism must either manufacture nucleotides or obtain them from their environment
5. Related organisms have many similar genes.
Where is the attachment site for RNA polymerase?
1. structural gene region
2. initiation region
3. promoter region
4. operator region
5. regulator region
What is an anticodon part of?
1. DNA
2. tRNA
3. mRNA
4. ribosome
5. activating enzyme
A part of an mRNA molecule with the following sequence is being read by a ribosome: 5' CCG--ACG 3' (mRNA). The following activated transfer RNA molecules are available. Two of them can correctly match the mRNA so that a dipeptide can form. The peptide that will form will be

tRNA Anticodon Amino Acid
GGC Proline
CGU Alanine
UGC Threonine
CCG Glycine
ACG Cysteine
CGG Alanine
1. cysteine--alanine
2. proline--threonine
3. glycine--cysteine
4. alanine--alanine
5. threonine--glycine
Which of the following is FALSE?
1. Transcriptionally produced gene products are molecules of RNA.
2. Proteins are translated only in the cytoplasm.
3. Steriod hormones may bind directly to DNA and regulate expression.
4. Histones are found only in eukaryotic chromosomes.
5. RNA polymerase attaches to DNA at the promoter sequence.
DNA has two functions: it can self-replicate and it can make non-DNA molecules. DNA is capable of these because
1. its two strands are held together by easily broken electrostatic interactions.
2. its nucleotides will form base pairs with both ribose and deoxyribose nucleotides.
3. both DNA and protein can be synthesized directly at the DNA template
4. its replication is semiconservative
5. replication and expression are thermodynamically spontaneous and require no enzymes
Once transcribed, eukaryotic mRNA typically undergoes substantial alteration that includes
1. excision of introns
2. fusion into circular forms known as plasmids
3. linkage to histone molecules
4. union with ribosomes
5. fusion with other newly transcribed mRNA
Which of the following is TRUE of both prokaryotic and eukaryotic gene expression?
1. After transcription, a 3' poly (A) tail and a 5' cap are added to mRNA
2. Translation of mRNA can begin before transcrition is complete.
3. RNA polymerase may recognize a promoter region upstream from the gene
4. mRNA is synthesized in the 3' --> 5' direction
5. The mRNA transcript is teh exact complement of the gene from which it was copied.
A particular eukaryotic protein is 300 amino acids long. Which of the following could be the number of nucleotides in the DNA that codes for this protein?
1. 3
2. 100
3. 300
4. 900
5. 1800
A particular triplet of bases in the coding sequence of DNA is AGT. What is the corresponding triplet in the complementary strand of DNA?
1. AGT
2. UCA
3. TCA
4. GAC
5. UUC
A particular triplet of bases in the coding sequence of DNA is AGT. The corresponding codon for the mRNA transcribed is
1. AGT
2. UCA
3. TCA
4. AGU
5. Either UCA or TCA depending on wobble in the first base.
A particular triplet of bases in the coding sequence of DNA is AGT. The anticodon on the tRNA that binds the mRNA codon is
1. AGT
2. UCA
3. TCA
4. AGU
5. Either UCA or TCA, depending on wobble in the first base.
Accuracy in the translation of mRNA into the primary structure of a protein depends on specificity in the
1. binding of ribosomes to mRNA
2. shape of the A and P sites of ribosomes.
3. bonding of the anticodon to the codon
4. attachment of amino acids to tRNA
5. Both C and D are correct
What are the coding segments of a stretch of eukaryotic DNA called?
1. introns
2. exons
3. codons
4. replicons
5. leprechaun
All of the following are directly involved in translation EXCEPT
1. mRNA
2. tRNA
3. ribosomes
4. DNA
5. aminoacyl-tRNA synthetase
The nitrogenous base adenine is found in all members of which of the following groups?
1. proteins, triglycerides, and testosterone
2. proteins, ATP and DNA
3. ATP, RNA and genes
4. alpha glucose, ATP and DNA
5. proteins, carbohydrates and ATP
RNA differs from DNA in that RNA
1. contains ribose as its sugar.
2. is found only in cytoplasm
3. contains uracil instead of thymine
4. Both A and C are correct
5. A, B, and C are correct
When ribosome firsts attaches to an mRNA molecule, one tRNA binds to the ribosome. The tRNA that recognizes the initiation codon binds to the
1. amino acid site (A site) of the ribosome only
2. peptide site (P site) of the ribosome only
3. large ribosome subunit (rRNA) only.
4. second tRNA before attaching to the ribosome
5. Both A and C are correct
From the following list, which is the first event in translation in eukaryotes?
1. elongation of the polypeptide
2. base pairing of activated methionine--tRNA to AUG of the messenger
3. binding of the larger ribosomal subunit to smaller ribosome subunits
4. covalent bonding between the first two amino acids
5. Both B and D occur simultaneously.
What type of bonding is responsible for maintaining the shape of the tRNA molecule?
1. covalent bonding between sulfur atoms
2. ionic bonding between phosphates
3. hydrogen bonding between base pairs
4. van der Waals interactions between hydrogen atoms
5. peptide bonding between amino acids
As ribosomes translocate along an mRNA molecule by one codon, which of the following occurs?
1. The tRNA that was in the A site moves into the P site.
2. The tRNA that was in the P site moves into the A site.
3. The tRNA that was in the P site departs from the ribosome
4. The tRNA that was in the A site departs from the ribosome.
5. Both A and C are correct.
A frameshift mutation could result from
1. a base insertion only
2. a base deletion only
3. a base substitution only
4. deletion of three consecutive bases
5. either an insertion or a deletion of a base
If the triplet UUU codes for the amino acid phenylalanine in bacteria, then in plants UUU should code for
1. leucine
2. valine
3. cystine
4. phenylalanine
5. proline
Which point mutation would be most likely to have a catastrophic effect on the functioning of a protein?
1. a base substitution
2. a base deletion near the start of the coding sequence
3. a base deletion near the end of the coding sequence, but not in the terminator codon
4. deletion of three bases near the start of the coding sequence, but not in the initiator codon.
5. a base insertion near the end of the coding sequence, but not in the terminator codon
Choose the answer that has these events of protein synthesis in the proper sequence.

1. An aminoacyl-tRNA binds to the A site
2. A peptide bond forms
3. tRNA leaves the P site and the P site remains vacant
4. A small ribosomal subunit associates with mRNA
5. tRNA translocates to the P site
1. 1,3,2,4,5
2. 4,1,2,5,3
3. 5,4,3,2,1
4. 4,1,3,2,5
5. 2,4,5,1,3
A portion of the genetic code is UUU=phenylalanine, GCC=alanine, AAA=lysine, and CCC=proline. Assume the correct code places the amino acids phenylalanine, alanine, and lysine in a protein (in that order). Which of the following DNA sequences would substitute proline for alanine?
1. AAA--CGG--TTA
2. AAT--CGG--TTT
3. AAA--CCG--TTT
4. AAA--GGG--TTT
5. AAA--CCC--TTT
The following DNA sequence shows a "gene" encoding a small peptide. The three "stop" codons are UAA, UAG, UGA.

promoter
5'(ATGACGTATAA)TGACCGTACATGAGTAATACATAAATCAG3'
3'(TACT GCATATT)ACTGGCATGTACTCATTATGTATTTAGTC5'

How many amino acids long will the small protein encoded by this "gene" be?
1. 3
2. 4
3. 5
4. 6
5. 7
Using the codon/amino acid table (get one if you don't have it), answer the following question.

A possible sequence of nucleotides in DNA that would code for the polypeptide Phe-Leu-Ile-Val would be
1. 5'TTG--CTA--CAG--TAG3'
2. 3'AAC--GAC--GUC--AUA5'
3. 5'AUG--CTG--CAG--TAT3'
4. 3'AAA-AAT-ATA--ACA5'
5. 3'AAA--GAA--TAA--CAA5'
Using the codon/amino acid table (get one if you don't have it), answer the following question.

What amino acid sequence will be generated, based on the following mRNA codon sequence? 5'AUG--UCU--UCG--UUA--UCC--UUG
1. met--arg--glu--arg--glu--agr
2. met--glu--arg--arg--gln--leu
3. met--ser--leu--ser--leu--ser
4. met--ser--ser--leu--ser--leu
5. met--leu--phe--arg--glu--glu
Using the codon/amino acid table (get one if you don't have it), answer the following question.

A peptide has the sequence NH2--phe--pro--lys--gly--phe--pro--COOH. What is the sequence in DNA that codes for this peptide?
1. 3'UUU--CCC--AAA--GGG--UUU--CCC
2. 3'AUG--AAA--GGG--TTT--CCC--AAA--GGG
3. 3'AAA--GGG--TTT--CCC--AAA--GGG
4. 5'GGG--AAA--TTT--AAA--CCC--ACT--GGG
5. 5'ACT--TAC--CAT--AAA--CAT--TAC--UGA
Using the codon/amino acid table (get one if you don't have it), answer the following question.

What is the sequence of a peptide based on the mRNA sequence 5'UUUUCUUAUUGUCUU ?
1. leu--cys--tyr--ser--phe
2. cyc--phe--tyr--cys--leu
3. phe--leu--ile--met--val
4. leu--pro--asp--lys--gly
5. phe--ser--tyr--cys--leu
What are ploysomes?
1. groups of ribosomes reading the same mRNA simultaneously.
2. ribosomes containing more than two subunits
3. multiple copies of ribosomes found associated with giant chromosomes
4. aggregations of vesicles containing ribosomal RNA
5. ribosomes associated with more than one tRNA
All of the following are found in prokaryotic messenger RNA EXCEPT
1. the AUG codon
2. the UGA codon
3. introns
4. uracil
5. cytosine
The first event in translation of eukaryotes (starting with methionine) is the
1. joining of the ribosomal units
2. base pairing of met-tRNA to AUG of the messenger RNA
3. binding of the large ribosomal subunit to
  AUG of mRNA
4. covalent bonding between the first two amino acids
5. forming of polysomes
During translation, chain elongation continues until what happens?
1. No further amino acids are needed by the cell.
2. All tRNAs are empty
3. The polypeptide is long enough
4. Chain terminator codons occur.
5. The ribosomes run off the end of mRNA
Which of the following represents a similarity between RNA and DNA?
1. The presence of a double-stranded helix
2. The presence of uracil
3. The presence of an OH group on the 2' carbon of the sugar.
4. Nucleotides consisting of a phosphate, sugar, and nitrogen base.
5. Repair systems that correct genetic code errors.
What are ribosomes composed of?
1. two subunits, each consisting of rRNA only
2. two subunits, each consisting of several proteins only
3. both rRNA and protein
4. mRNA, rRNA and protein
5. mRNA, tRNA, rRNA and protein
All of the following are transcribed from DNA EXCEPT
1. protein
2. exons
3. rRNA
4. tRNA
5. mRNA
Where is eukaryotic robosomal RNA transcribed?
1. the Golgi aparatus
2. ribosomes
3. nucleoli
4. X chromosomes
5. prokaryotic cells only
The anticodon ACC codes for phenylalanine. Which of the following triplets of bases on the mRNA strand codes for this amino acid?
1. UGG
2. GUG
3. GUA
4. UUC
5. CAU
Which of the following does NOT occur during the termination phase of translation?
1. A termination codon moves into the A site.
2. The newly formed polypeptide is released.
3. A tRNA with the next amino acid enters the P site.
4. The two ribosomal subunits separate.
5. Translation stops
Which of the following DNA mutations is the most potentially damaging to the protein it specifies?
1. a base-pair deletion
2. a codon substitution
3. a substitution in the last base of a codon
4. a codon deletion
5. a point mutation
Beadle and Tatum proposed the one gene-one enzyme concept. In its original form, this hypothesis could be restated in which of the following ways?
1. One DNA molecule contains the information to make one enzyme
2. A given sequence of DNA nucleotides contains the information to make one enzyme.
3. Each gene contains the information to make one enzyme, one lipid, and one charbohydrate.
4. Each gene is actually an enzyme that catalyzes the production of one protein.
5. Each polypeptide is the result of the activity of one enzyme.
According to the signal hypothesis, ribosomes are directed to the ER membrane
1. by a specific characteristic of the ribosome itself, which distinguishes free ribosomes from bound ribosomes
2. by a certain amino acid sequence at the beginning fo the polypeptide chain being synthesized by the ribosome.
3. by moving through a channel from the nucleus
4. by a chemical signal given off by the ER
5. by a signal sequence of RNA that precedes the start codon of the message